Geek T-Shirt

I just had an idea for a geeky T-shirt:

In just seven days…

TTTCGCATTCTGGGATTCTCTAGAGCCATCTTGCGCCTCTGATCGCGAGACCACACGATGAATGCGTTCA
TGGGTCGCTTCACTCTATCCTGGACGTTGCCTTTACTGTTTTCTCCCGTTTCACACTGATACTTAGAGTT
ACAGCTTTCAGTGCAAAGGAAGGAAGAGCTTCTCCGGAG

SRY protein

… I can make you a man!

(For those who haven’t memorized the human genome, that’s the SRY gene, which is found on the Y chromosome and makes embryos develop as males.)

(Well, mostly.)

This entry was posted in :-), Geek, Science and tagged , , , , , . Bookmark the permalink.

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s